View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_218 (Length: 265)
Name: NF10140A_low_218
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10140A_low_218 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 7 - 253
Target Start/End: Original strand, 9443303 - 9443549
Alignment:
Q |
7 |
taagatatgtgattttatggaaaattgcatccaaagttgattctaactcgaaactagaacttatagtttttgtctctaccattgatttttattcttaaat |
106 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9443303 |
taagatatgtgattttatggaaaattgcttccaaagttgattctaactcgaaactagaacttatagtttttgtctctaccattgatttttattcttaaat |
9443402 |
T |
 |
Q |
107 |
ttatcgtttagttttagcgcatgtttgttaacctggtatactaccatgatttttgcgaagccggaaatcagagagttgggaaacatacgaacaaacactg |
206 |
Q |
|
|
|||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9443403 |
ttatggtttagttttagcgcatgtttgtaaacctggtatactaccatgatttttgcgaagccggaaatcagagagttgggaaacatacgaacaaacactg |
9443502 |
T |
 |
Q |
207 |
atgtagccatgattaattttttataaccaattcattcaaattatatt |
253 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
T |
9443503 |
atgtagccatgattaagtttttataaccaattcattcaaactatatt |
9443549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University