View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_241 (Length: 253)
Name: NF10140A_low_241
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_241 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 9 - 241
Target Start/End: Original strand, 42039403 - 42039635
Alignment:
| Q |
9 |
agatggacatcatgatgttgagataagcactctatatcctggtgaatcattcaggagcttggaggattgctttgagagctttgttgccatggcggccgac |
108 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42039403 |
agatggaattcatgatgttgagataagcactctatatcctggtgaatcattcaggagcttggaggattgctttgagagctttgttgccatggcggccgac |
42039502 |
T |
 |
| Q |
109 |
aagattcataaaggagaaaatggagttaccggcggcacgaaggctttagtagaaccagtgccaatcacagcttcctgttgaagagtttcacctcaaaaac |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42039503 |
aagattcataaaggagaaaatggagttaccggtggcacgaaggctttagtagaaccagtgccaatcacagcttcctgttgaagagtttcacctcaaaaac |
42039602 |
T |
 |
| Q |
209 |
cgtcctaggttattctttattgaggtggatatt |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42039603 |
cgtcctaggttattctttattgaggtggatatt |
42039635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University