View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10140A_low_244 (Length: 252)

Name: NF10140A_low_244
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10140A_low_244
NF10140A_low_244
[»] chr2 (2 HSPs)
chr2 (157-252)||(31658583-31658678)
chr2 (18-55)||(31658521-31658558)


Alignment Details
Target: chr2 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 157 - 252
Target Start/End: Original strand, 31658583 - 31658678
Alignment:
157 ccaatgccaaactttgaaaataaatttacacttagacagaaacatatccatagccatcaaaatcctaactggtcataaacattctcaaattcaaat 252  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31658583 ccaatgccaaactttgaaaataaatttacacttagacagaaacatatccatagccatcaaaatcctaactggtcataaacattctcaaattcaaat 31658678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 18 - 55
Target Start/End: Original strand, 31658521 - 31658558
Alignment:
18 gacatcataagttaaacgatcaaataaatctcccatta 55  Q
    ||||||||||||||||||||||||||||||||||||||    
31658521 gacatcataagttaaacgatcaaataaatctcccatta 31658558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University