View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_251 (Length: 251)
Name: NF10140A_low_251
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_251 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 9867844 - 9868088
Alignment:
| Q |
1 |
tgtggtttgcctttagtagcgatcttagtggtaattggatcacactgtctagaaaagttttattcacgtggaatttagtcatgcatgactaaacaaatat |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
9867844 |
tgtggtttgcctttagtagcgatcgtagtggtaattggatcacaccatctagaaaagttttattaacgtggaatttagtcatgcatggctaaacaaatat |
9867943 |
T |
 |
| Q |
101 |
gactcaatcatcatattcacgatgcatgacgaaatcatgatcaaagagagactggcgtcgcttctttatatttcaccaatgttccaaagcaatttttgta |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
9867944 |
gattcaatcatcatattcacgatgcatggcgaaatcatgatcaaagagagactggcgtcgcttccttatatttcaccaatgttccaaagcaatttttgta |
9868043 |
T |
 |
| Q |
201 |
tgttgaattaaggatagggtttgatgtgtgtggtatattcttcga |
245 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
9868044 |
tgttgaattaaggaaagggtttgatgtgtgtggtatattgttcga |
9868088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University