View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_256 (Length: 250)
Name: NF10140A_low_256
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_256 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 8 - 241
Target Start/End: Complemental strand, 10820810 - 10820577
Alignment:
| Q |
8 |
caaagggatagtaatgattaagtatttgtgctagagaagttttaagattgttaacaaaagatttgaagttacctagttttggttttttgtagaaatacaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10820810 |
caaagggatagtaatgattaagtatttgtgctagagaagttttaagattgttaacaaaagatttgaagttacctagttttggttttttgtagaaatacaa |
10820711 |
T |
 |
| Q |
108 |
gtatgtaactggaaaacgaccagaaagtagatcaagatttgagagattaatcactgaaaatggctttggaaaatgattgagagcttttacaacacttttc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10820710 |
gtatgtaactggaaaacgaccagaaagtagatcaagatttgagagattaatcactgaaaatggctttggaaaatgattgagagcttttacaacacttttc |
10820611 |
T |
 |
| Q |
208 |
ttaatgaactttacttcaaatttttcatattctt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
10820610 |
ttaatgaactttacttcaaatttttcatattctt |
10820577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University