View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_263 (Length: 250)
Name: NF10140A_low_263
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_263 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 19 - 235
Target Start/End: Complemental strand, 35750454 - 35750239
Alignment:
| Q |
19 |
agcgtacagttaggacgcatcaaataccacgttcgacgaataatgggcaatggtcatgtggagaggggaagtccaacatggctaagtttggagcaaatct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35750454 |
agcgtacagttaggacgcatcaaataccacgttccacggataatgggcaatagtcatgtggagaggggaagtccaacatggctaagtttggagcaaatct |
35750355 |
T |
 |
| Q |
119 |
tggatgatgtttacggagggttgatttatcatcgaaggcggggggtggccatgctacctaatagctttttgactgtgttgtaacatttggataatttata |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35750354 |
tggatgatgtttacggagggttgatttatcatcgaaggcg-ggggtggccatgctacctaatagttttttgactgtgttgtaacatttggataatttata |
35750256 |
T |
 |
| Q |
219 |
ttggatactatttttat |
235 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
35750255 |
ttggatactatttttat |
35750239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 115 - 159
Target Start/End: Complemental strand, 18348590 - 18348546
Alignment:
| Q |
115 |
atcttggatgatgtttacggagggttgatttatcatcgaaggcgg |
159 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||| |||||| |
|
|
| T |
18348590 |
atcttggatgaggtttagggagggttgatttatcatcggaggcgg |
18348546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University