View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10140A_low_265 (Length: 250)

Name: NF10140A_low_265
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10140A_low_265
NF10140A_low_265
[»] chr8 (2 HSPs)
chr8 (159-240)||(41405396-41405477)
chr8 (14-82)||(41405269-41405337)


Alignment Details
Target: chr8 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 159 - 240
Target Start/End: Original strand, 41405396 - 41405477
Alignment:
159 ccaaatgaacaaattgctgagcttattaagcaatacaaaggatacaatccctacatgactcaatactatcatgttcagagtg 240  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41405396 ccaaatgaacaaattgctgagcttattaagcaatacaaaggatacaatccctacatgactcaatactatcatgttcagagtg 41405477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 14 - 82
Target Start/End: Original strand, 41405269 - 41405337
Alignment:
14 agaccctgttgatgttgtgagcaaattgagaaaaacttggcacacagaaattttaacggttgggccggc 82  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41405269 agaccctgttgatgttgtgagcaaattgagaaaaacttggcacacagaaattttaacggttgggccggc 41405337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University