View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_268 (Length: 250)
Name: NF10140A_low_268
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10140A_low_268 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 16 - 243
Target Start/End: Complemental strand, 31171114 - 31170887
Alignment:
Q |
16 |
tggacatcagctgcacaactatcattacttgaagacgaaatgcgccgtatagaaagagtcaatgtaaggccaaagtcataaaagtttatttcttcctttt |
115 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31171114 |
tggacatcagctgcacaactatcattacttgaagacgaaatgcgccgtatagaaagagtcaatgtaaggccaaagtcataaaagtttatttcttcctttt |
31171015 |
T |
 |
Q |
116 |
ccctccttaagatctctgttcgtaagataatttcataatgtcgtannnnnnncctttctgcacaatggctactaatttatgacaaacaattttgagcaaa |
215 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
T |
31171014 |
ccctccttaagatctctgttcgtaagataatttcataatgtcgtattttttccctttctgctcgatggctactaatttatgacaaacaattttgagcaaa |
31170915 |
T |
 |
Q |
216 |
tatcacttgctttttaacttttcatact |
243 |
Q |
|
|
|||||||||||||||||||||||||||| |
|
|
T |
31170914 |
tatcacttgctttttaacttttcatact |
31170887 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr2 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 16 - 86
Target Start/End: Complemental strand, 35224494 - 35224424
Alignment:
Q |
16 |
tggacatcagctgcacaactatcattacttgaagacgaaatgcgccgtatagaaagagtcaatgtaaggcc |
86 |
Q |
|
|
|||||||| |||||||| ||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
35224494 |
tggacatctgctgcacagctatcattactcgaagatgaaatgcgccgtatagaaagagtcaatgtaaggcc |
35224424 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University