View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_273 (Length: 249)
Name: NF10140A_low_273
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10140A_low_273 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 16 - 224
Target Start/End: Original strand, 7430821 - 7431022
Alignment:
Q |
16 |
ggacatcaaaaccaatctttcatctaatgcaaaagtaagctagctattcaagcaaacacaatgtcaaaacgatcaccttcacagtaatcaaaacaaaatc |
115 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || ||||||||||||| |
|
|
T |
7430821 |
ggacatcaaaaccaatctttcatctaatgcaaaagtaagctagctattcaagcaaacacaatttcaaaacgatcaccttcacactattcaaaacaaaatc |
7430920 |
T |
 |
Q |
116 |
aagttctatataacccatatagcaccaaccaccaagacttcacatacagttacattcaatattacatgttttaatactattaccggtgtcaacatgtccg |
215 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7430921 |
aagttctatataacccatatag-------caccaagacttcacatccagttacattcaatattacatgttttaatactattaccggtgtcaacatgtccg |
7431013 |
T |
 |
Q |
216 |
gtgtctgtg |
224 |
Q |
|
|
||||||||| |
|
|
T |
7431014 |
gtgtctgtg |
7431022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University