View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_276 (Length: 249)
Name: NF10140A_low_276
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_276 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 12 - 244
Target Start/End: Original strand, 40098040 - 40098290
Alignment:
| Q |
12 |
atgaagagcggagcggccgtcagtgtcacggaaattgacgtcactaccgtcgtctagaagttcggtgattccttctaagtcaccttcgttcgctaaatac |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40098040 |
atgaagagcggagcggccgtcagtgtcacggaaattgacgtcactaccgtcgtctagaagttcggtgattccttctaagtcaccttcgttcgctaaatac |
40098139 |
T |
 |
| Q |
112 |
atcaaccgaacggtgggatccacca------------------agtcggttacagttacggagtcggttaccagtgagttgacggtggcggaaccgtcgt |
193 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40098140 |
atcaaccgaacggtgggatccaccaagtcggttacagttacggagtcggttacagttacggagtcggttaccagtgagttgacggtggcggaaccgtcgt |
40098239 |
T |
 |
| Q |
194 |
gatccggtgcgagggaagattgtctgccaagtgagaaacgagagtgaagct |
244 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40098240 |
gatccggtgcgagggaagattgtctgccgagtgagaaacgagagtgaagct |
40098290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University