View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_288 (Length: 248)
Name: NF10140A_low_288
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_288 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 18 - 236
Target Start/End: Original strand, 22671791 - 22672009
Alignment:
| Q |
18 |
acatcatgttgggttgatgggcatgttggatggaagtggcgatgaaggttgttgtcatgggatatggaacaaaagggggagtgtagtctttcgatgtcta |
117 |
Q |
| |
|
|||| ||| |||||| |||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| || |||| ||| |||||||||||||| |
|
|
| T |
22671791 |
acattatgatgggttaatgggcattttggatggaagtggcgatgaaggttgttgtcatgggataaggaacaactggtggagcgtattctttcgatgtcta |
22671890 |
T |
 |
| Q |
118 |
atattttcttgctagatggtgtggaagacaagtgggattggagtatttatccaagaaaaggatactttatccgaggagcctagcctatcatatcatttct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
22671891 |
atattttcttgctagatggtgtggaagacaagtgggattggagtatttatccaagaaaaggatactatatccgaggagcctagcctatcatatcctttct |
22671990 |
T |
 |
| Q |
218 |
tatgtggtgcaaacatatt |
236 |
Q |
| |
|
| ||||||||||||||||| |
|
|
| T |
22671991 |
tctgtggtgcaaacatatt |
22672009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 95 - 199
Target Start/End: Complemental strand, 15724557 - 15724453
Alignment:
| Q |
95 |
ggagtgtagtctttcgatgtctaatattttcttgctagatggtgtggaagacaagtgggattggagtatttatccaagaaaaggatactttatccgagga |
194 |
Q |
| |
|
|||||| ||||||| | ||||| | |||||||||| ||||||||||||||||||||||| |||||| || ||| ||| ||||| ||||| |||||||| |
|
|
| T |
15724557 |
ggagtgcagtcttttgttgtctcacattttcttgcaggatggtgtggaagacaagtgggactggagtcttgatcaaagcaaagggtacttcgtccgagga |
15724458 |
T |
 |
| Q |
195 |
gccta |
199 |
Q |
| |
|
||||| |
|
|
| T |
15724457 |
gccta |
15724453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 95 - 199
Target Start/End: Original strand, 1591608 - 1591712
Alignment:
| Q |
95 |
ggagtgtagtctttcgatgtctaatattttcttgctagatggtgtggaagacaagtgggattggagtatttatccaagaaaaggatactttatccgagga |
194 |
Q |
| |
|
|||||| ||||||| | ||||| | |||||||||| ||||||||||||||||||||||| |||||| || ||| ||| ||||| ||||| |||||||| |
|
|
| T |
1591608 |
ggagtgcagtcttttgttgtctcacattttcttgcaggatggtgtggaagacaagtgggactggagtcttgatcaaagcaaagggtacttcgtccgagga |
1591707 |
T |
 |
| Q |
195 |
gccta |
199 |
Q |
| |
|
||||| |
|
|
| T |
1591708 |
gccta |
1591712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University