View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_289 (Length: 248)
Name: NF10140A_low_289
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_289 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 21 - 225
Target Start/End: Original strand, 36449486 - 36449690
Alignment:
| Q |
21 |
cagccagtagttctgtagatgatttcattaaggaaggtctgaagttagataatttttactctctctgacctttattttttattttgtttgataaaataaa |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36449486 |
cagccagtagttctgtagatgatttcattaaggaaggtctgaagttagataatttttactctctctgaactttattttttattttgtttgataaaataaa |
36449585 |
T |
|
| Q |
121 |
agactttatacattgaaaagagaagtacaaaatcagaagttgtcctaaagttgctagaattccttcggaaaccaacaatagtaattctgataccccttca |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36449586 |
agactttatacattgaaaagagaagtacaaaatcagaagttgtcctaaagttgctagaataccttcagaaaccaacaatagtaattctgataccccttca |
36449685 |
T |
|
| Q |
221 |
tgtgt |
225 |
Q |
| |
|
||||| |
|
|
| T |
36449686 |
tgtgt |
36449690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University