View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_301 (Length: 247)
Name: NF10140A_low_301
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_301 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 49 - 239
Target Start/End: Original strand, 28678278 - 28678469
Alignment:
| Q |
49 |
tacagagcaatggcaaagcatattaatgtgtgtgtataaaagcataaaaacatagtagaggaattggaacacttatatacttgtatcgtgcatgta-taa |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || |
|
|
| T |
28678278 |
tacagagcaatggcaaagcatattaatgtgtgtgtataaaagcataaaaacatagtagaggaattggaacacttatatacttgtatcgtggatgtacaaa |
28678377 |
T |
|
| Q |
148 |
attgaatgaaaaataagcattagtcgaagaggattgatgaaaaatagttctggaaacacagatttgaatttatcaatttaataggtcaatgt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
28678378 |
attgaatgaaaaataagcattagtcgaagaggattgatgaaaaatagttctggaaacacagatttgaattcataaatttaataggtcaatgt |
28678469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University