View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_303 (Length: 247)
Name: NF10140A_low_303
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_303 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 10 - 235
Target Start/End: Complemental strand, 5837838 - 5837613
Alignment:
| Q |
10 |
catcagataacaaggcatatagctcatttggggactctgtagggtcatggtcacttagcagaagcaggaacggtttggttttacaacgatgaccggtatg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5837838 |
catcagataacaaggcatatagctcatttggggactctgtagggtcatggtcacttagcagaagcaggaacggtttggttttacaacgatgaccggtatg |
5837739 |
T |
|
| Q |
110 |
gaaccgttcgtcgcaattaaaacacaaaccctggcttcggcgcagttgcagctcacttggggagaggcagcgtatagggatagatctggtggatcaggcg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5837738 |
gaaccgttcgtcgcaattaaaacacaaaccctggcttcggcgcagttgcagctcgcttggggagaggcagcgtatagggatagatctggtggatcaggcg |
5837639 |
T |
|
| Q |
210 |
gtttgtgtggcggggttggtaatatt |
235 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
5837638 |
gtttgtgtggcggggttggtaatatt |
5837613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University