View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_315 (Length: 244)
Name: NF10140A_low_315
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_315 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 18 - 216
Target Start/End: Complemental strand, 36166948 - 36166751
Alignment:
| Q |
18 |
cattatgggaggggattactcgctttaggttcttcctagggatgtcttggaccattgctcttaggcgttgaaggaaggagatggtgattggggaccgaag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
36166948 |
cattatgggaggggattactcgctttaggttcttcctagggatgtcttgggccattgctcttaggtgttgaaggaaggagatggtgattggggaccgaag |
36166849 |
T |
|
| Q |
118 |
ccatttagatttaataatcattagttgaataatagaaatttcaaaaggggtggaggaggaggcttgggaagagtttcaagtgattgggtagatgggttt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |||| |||| |
|
|
| T |
36166848 |
ccatttagatttaataatcattagttgaataatagaaatttcaaaa-gggtggaggaggaggcttgggaagagtttcaagtgatcgggtggatgagttt |
36166751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University