View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_330 (Length: 241)
Name: NF10140A_low_330
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_330 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 24 - 223
Target Start/End: Original strand, 22362099 - 22362301
Alignment:
| Q |
24 |
cttaataccatggtatattctgttgcacttggattcacatgtggtgccatcattgatccctaacatacacaacgcatgaaaaagaaaagatgaataagaa |
123 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
22362099 |
cttaatactatggtatactctgttgcacttggattcacatgtggtgccatcattgatccctaacatacacaatgcatgaaatagaaaagatgaataagaa |
22362198 |
T |
 |
| Q |
124 |
cc---cagcaagatcatggttaaaatatgtaaggtcttgtttgtttgcataccgcggtgagattgacgtgaaaaacgccgatatcaggtattttgagcgg |
220 |
Q |
| |
|
|| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22362199 |
cccagcagcaatatcatggttaaaatatgtaaggtcttgtttgtttgcataccgcggtgagattgacgtgaaaaacaccgatatcaggtattttgagcgg |
22362298 |
T |
 |
| Q |
221 |
aga |
223 |
Q |
| |
|
||| |
|
|
| T |
22362299 |
aga |
22362301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University