View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_337 (Length: 240)
Name: NF10140A_low_337
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_337 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 24 - 115
Target Start/End: Complemental strand, 48769575 - 48769484
Alignment:
| Q |
24 |
aaaatatttcacaagggaatcatgtcatggatattttatcagtattttcgtattaatgtttctttccgaaatttttccatttcttacaatat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48769575 |
aaaatatttcacaagggaatcatgtcatggatattttatcagtattttcgtattaatgtttctttccgaaatttttccatttcttacaatat |
48769484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 178 - 227
Target Start/End: Complemental strand, 48769488 - 48769439
Alignment:
| Q |
178 |
aatatatagcctgattttgtatttttgtcttccattttttagtgatgtcc |
227 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
48769488 |
aatatatagcctgattttgtacttttgtcttccattttttagtgatgtcc |
48769439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University