View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_348 (Length: 238)
Name: NF10140A_low_348
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_348 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 4 - 238
Target Start/End: Complemental strand, 19612609 - 19612374
Alignment:
| Q |
4 |
tatttgaatcactaatattcaatacattcaatcataattcggttattgacatgg-tatgacttaatttgagaaacttgctttgattgactattttgttta |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
19612609 |
tatttgaatcactaatattcaatacattcaatcataattcggttattgacatgggtatgacttaatttgagaaacttgctttgattgattattttcttta |
19612510 |
T |
 |
| Q |
103 |
actcagatttttgctttctatcaattttgggtacatagatttgtcctagttcttccagattaattaatttttgcaaataaactctttagattccctttaa |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
19612509 |
actcagatttttgctttctatcaattttgggtacatagatttgtcctagttcttccagattaattaatttttgcaaatatactctttagattccctttaa |
19612410 |
T |
 |
| Q |
203 |
ttcttgcagttgaattcagatgtctgaggcctttaa |
238 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
19612409 |
ttcttggagttgaattcagatgtctgagacctttaa |
19612374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University