View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_368 (Length: 234)
Name: NF10140A_low_368
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_368 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 35 - 219
Target Start/End: Original strand, 8927555 - 8927739
Alignment:
| Q |
35 |
atggacatcataaagagtcattgccatgttcaaggcacccatccagtcacctgctttccgtaaaaccaagatacgctctttccaagggagaagacgagaa |
134 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8927555 |
atggccatcataaagagtcattgccatgttcaaggcacccatccagtcacctgctttccgtaaaaccaagatacgctctttccaagggagaagacgagaa |
8927654 |
T |
 |
| Q |
135 |
atgataagatgtgttggaccaagtatataaatagaagttcctcttacagcaatggcgttatgataagctttctcaggatttccat |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8927655 |
atgataagatgtgttggaccaagtatataaatagaagttcctcttacagcaatggcgttatgataagctttctcaggatttccat |
8927739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University