View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_370 (Length: 234)
Name: NF10140A_low_370
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_370 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 27 - 220
Target Start/End: Complemental strand, 12552219 - 12552026
Alignment:
| Q |
27 |
tctaacacttagtgatggaattagagacgaaatcattttttccgtctgtgaaattccgtcgctatctttagagtgatttcaataacattttctacataag |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
12552219 |
tctaacacttagtgatggaattagagacgaaattattttttccgtctctgaaattccgtcgctatctttagagtgatttcaatatcattttctacataag |
12552120 |
T |
 |
| Q |
127 |
aaaaaacaagttaagaaatatacttgtttccaagaactgaatgaaggttgatgataactctttcttcttcatctgtgaatttccctctcttgat |
220 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
12552119 |
aaaaaacaagataagaaatatacttgtttccaagaactgaatgaaggttgatgataactctttcttcttcatcagtgaatttccctctcttgat |
12552026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University