View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_378 (Length: 232)
Name: NF10140A_low_378
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_378 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 41 - 232
Target Start/End: Original strand, 53012860 - 53013051
Alignment:
| Q |
41 |
catttgcttcttaaaaacatggtttcgggttggaattcgtacgaaaatgtttaaactaacaatatcgatatttatcgatttgagttaagctttatgaaca |
140 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
53012860 |
catttgcttcttaaaagcatggtttcaggttggaattcgtacgaaaatgtttaaactaacaatatcgatatttatcggtttgagttaagttttatgaaca |
53012959 |
T |
|
| Q |
141 |
aatataaagagtgaatgctatactgtaaaattatagatagcaatattttcaaccgtaacaatcattacaagattttgttattagtgatatga |
232 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53012960 |
aatataaagagtgaatgttgtactgtaaaattatagatagcaatattttcaaccgtaacaatcattacaagattttgttattagtgatatga |
53013051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University