View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_384 (Length: 231)
Name: NF10140A_low_384
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_384 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 29 - 211
Target Start/End: Original strand, 33435351 - 33435533
Alignment:
| Q |
29 |
tgttccctagcaacatctttactatatcaaatcactcacactttctatttgatatctatcctggttggtgtagtatgcataagctaacatgaggctttta |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33435351 |
tgttccctagcaacatctttactatatcaaatcactcacactttctatttgatatctatcctggttggtgtagtatgcataagctaacatgaggctttta |
33435450 |
T |
|
| Q |
129 |
taacccggaagaggatatatgttatactatgttggcccctctatcactttaattggtttcaactgctaacaatagcaggtcgt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33435451 |
taacccggaagaggatatatgttatactatgttggcccctctatcactttaattggtttcaactactaacaatagcaggtcgt |
33435533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University