View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_385 (Length: 231)
Name: NF10140A_low_385
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10140A_low_385 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 17 - 212
Target Start/End: Complemental strand, 23231909 - 23231714
Alignment:
Q |
17 |
ggacatcacattagtaacttacacaaaaatgaaccacatatattaatttcttaacaaattcgaagtccaacattaacgtacacaaaaattttaaagacaa |
116 |
Q |
|
|
||||| ||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
23231909 |
ggacagcacattagtaacttacacaaaaaggaggcacatatattaatttcttaacaaattcgaagtccaacattaacgtacacaaaaactttaaagacaa |
23231810 |
T |
 |
Q |
117 |
aactatagtacattttgatggaaacaataattaaacaacatcaagattaaacaaaaacatggtacatataatgctcttaatcatttctctgtgttt |
212 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
T |
23231809 |
aactatagtacattttgatggaaacaataattaaacaacatcaagattaaacaaaaacatggtacatataatgttcttaatcatttctctttgttt |
23231714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University