View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_392 (Length: 230)
Name: NF10140A_low_392
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_392 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 145 - 217
Target Start/End: Original strand, 6703330 - 6703402
Alignment:
| Q |
145 |
gttattcatcattatagtcgattttctaggacattttatcaagaatattatgatagagtacctagtgttatat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6703330 |
gttattcatcattatagtcgattttctaggacattttatcaagaatattatgatagagtacctagtgttatat |
6703402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 6703185 - 6703239
Alignment:
| Q |
1 |
tcagaatttgtgtttatgccattgatcatattaatttggtatgatattcttccaa |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6703185 |
tcagaatttgtgtttatgccattgatcatattaatttggtatgatattcttccaa |
6703239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 167 - 207
Target Start/End: Original strand, 8731061 - 8731101
Alignment:
| Q |
167 |
tttctaggacattttatcaagaatattatgatagagtacct |
207 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
8731061 |
tttctaggaaattttatcaagaatatcttgatagagtacct |
8731101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University