View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_400 (Length: 230)
Name: NF10140A_low_400
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_400 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 3775916 - 3776144
Alignment:
| Q |
1 |
ttaatatttccccgaaaaacggattcattagaccggaggcactgcagattcatgtgccctatgttggggaagaaaagagtgatgaacattccatcaaatc |
100 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||| ||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3775916 |
ttaatatttcccagaaaaatggattcattagaccggaagcactgcggattcatgtaccctatgttggggaagaaaagagtgatgaacattccatcaaatc |
3776015 |
T |
|
| Q |
101 |
ttctgacacatcaacaacgctgacagaagatgcagctgccagcagttctgttgaacaagttatgccaaattgtcaaagcttccaaccgcaagttccgtac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3776016 |
ttctgacacatcaacaacgctgacagaagatgcagctgccagcagttctgttgaacaagttatgccaaattgtcaaagcttccaaccacaagttccgtac |
3776115 |
T |
|
| Q |
201 |
tatcccagtgccccttggcttttgccgtg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3776116 |
tatcccagtgccccttggcttttgccgtg |
3776144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University