View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_402 (Length: 230)
Name: NF10140A_low_402
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_402 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 30841576 - 30841800
Alignment:
| Q |
1 |
accacgtcacagagaccattgttgggttacgagaggagcctgatggatcatcctcattagactaagagcgatcatacaagtgaattgtacaccccatctt |
100 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||| |||||||||||| |||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
30841576 |
accacgtcacagagaccactgttgcgttacgagaggagcccgatggatcatccacattggactcagagcgatcatacaagtgaattgtacaccccatctt |
30841675 |
T |
 |
| Q |
101 |
tactcaaaatcgtaaccttcacttttaaaacaatgtaaaacttctacctcatatttgctaaacaacattaattatnnnnnnntgtggttggtccatttct |
200 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30841676 |
tactcaaaatcgtaacctccactttttaaacaatgtaaaacttctacctcatatttgctaaacaacattaattataaaaaaatgtggttggtccatttct |
30841775 |
T |
 |
| Q |
201 |
ttatttcctcgtactaggggttatt |
225 |
Q |
| |
|
||||||||||||||||| ||||||| |
|
|
| T |
30841776 |
ttatttcctcgtactagcggttatt |
30841800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University