View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_409 (Length: 229)
Name: NF10140A_low_409
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10140A_low_409 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 1329864 - 1330086
Alignment:
Q |
1 |
atttgacgagagtgcagattgggaaacagcgttggtacaatcaaccagccacttaggaaaccagcagcctgcattaggtggaggctttgatacattattg |
100 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1329864 |
atttgatgagagtgcagattgggaaacagcgttggtacaatcaaccagccacttaggaaaccagcagcctgcattaggtggaggctttgatacattattg |
1329963 |
T |
 |
Q |
101 |
ttggatggtatgtataaacaaggagaaatgaatgcagccatgcaaggagtgggatatggttgcagtggaagtgctagcagtgtagcacttggttcagccg |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1329964 |
ttggatggtatgtataaacaaggagaaatgaatgcagccatgcaaggagtgggatatggtggcagtggaagtgctagcagtgtagcacttggttcagccg |
1330063 |
T |
 |
Q |
201 |
gaaggccagcaatgctagcattg |
223 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
1330064 |
gaaggccagcaatgctagcattg |
1330086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University