View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_42 (Length: 404)
Name: NF10140A_low_42
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_42 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 361; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 361; E-Value: 0
Query Start/End: Original strand, 2 - 398
Target Start/End: Complemental strand, 7753143 - 7752747
Alignment:
| Q |
2 |
gataagttgttggacgaaaggtcaatgtttagagcagggatcttgaatgagccgaaactctcagggattgagccggttagctggttttgaaatagggaaa |
101 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7753143 |
gataagttgttggacgaaaggtcgatgtttagagcagggttcttgaatgagccgaaactctcagggattgagccggttaactggttttgaaatagggaaa |
7753044 |
T |
|
| Q |
102 |
gttcgttgagtttaggaagttgagctaaagaagctggaattgggccagataagttgttaatgtatatgtagagttgttctaggctcttgatcatgcctaa |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7753043 |
gttcgttgagtttaggaagttgagctaaagaagctggaattgggccagataagttgttaatgtatatgtagagttgttctaggctcttgatcatgcctaa |
7752944 |
T |
|
| Q |
202 |
ggaggctgggattgggccggagagttggtttgagccaaggtgagcgcttctaagcttagtgagtcgacctagtgatgcagggatttggccggtaaacctg |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7752943 |
ggaggctgggattgggccggagagttggtttgagccaaggttagcgcttctaagcttggtgagtcgacctagtgatgcagggatttggccggtaaacctg |
7752844 |
T |
|
| Q |
302 |
ttcccggagaggtcgatgacatcgaggttcttgagtcgacctaagaaatcagggattgggccggtgagactgtccaagctaaagtcgaggtggacaa |
398 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
7752843 |
ttcccagagaggtcgatgacatcgaggttcttgagttgacctaagaaatcagggattgggcctgtgagactgtccaagctaaagtcgaggtgaacaa |
7752747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University