View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_420 (Length: 227)
Name: NF10140A_low_420
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_420 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 19 - 208
Target Start/End: Original strand, 3675346 - 3675535
Alignment:
| Q |
19 |
aaaatcaatcacagctgcagttgtaggtcgaaatatattattcccagtgataagttcatgaatttgacgatacacttggcttcctgtgtatatacttgta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3675346 |
aaaatcaatcacagctgcagttgtaggtcgaaatatattattcccagtgataagttcatgaatttgacgatacacttggcttcctgtgtatatacttgta |
3675445 |
T |
 |
| Q |
119 |
aaaaatgctaccacaagcaaatacctaagattnnnnnnnttattaattaaagttccatacaaattaaattttgacaaaaacccatcatat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3675446 |
aaaaatgctaccacaagcaaatacctaagattaaaaaaattattaattaaagttccatacaaattaaattttgacaaaaacccatcatat |
3675535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University