View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_426 (Length: 227)
Name: NF10140A_low_426
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_426 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 14 - 227
Target Start/End: Complemental strand, 12843893 - 12843680
Alignment:
| Q |
14 |
gatatgattccggtcagtctctgcaattttctccgtcatcctaaggacaccttcgttggattctggaacgctgctgatcgtagaaggctggagagatttg |
113 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12843893 |
gatatgattccggttagtctctgcaactttctccgtcatcctaagaacaccttcgttggattctggaacgctgctgatcgtagaaggctggagagatttg |
12843794 |
T |
|
| Q |
114 |
gtcatcgcttgcaaatgtggaaagatcctcaggatctgaggcattacaggttcaatggtgaaaatctttcacgtgaatcgatgaatgtaattgtggggaa |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
12843793 |
atcatcgcttgcaaatgtggaaagatcctcaggatctgaggcattacaggttcaatggtgaaaatctttcacgtgaatcgataaatgtaattgtgaggaa |
12843694 |
T |
|
| Q |
214 |
ttggcttgatttcg |
227 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
12843693 |
ttggcttgatttcg |
12843680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 7 - 226
Target Start/End: Original strand, 12861581 - 12861800
Alignment:
| Q |
7 |
tcgcgcagatatgattccggtcagtctctgcaattttctccgtcatcctaaggacaccttcgttggattctggaacgctgctgatcgtagaaggctggag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| | ||||||| |
|
|
| T |
12861581 |
tcgcgcagatatgattccggtcagtctctgcaattttctccgtcatcctaagaacaccttcgttggattctggaacgctgcagatcgtaggaagctggag |
12861680 |
T |
|
| Q |
107 |
agatttggtcatcgcttgcaaatgtggaaagatcctcaggatctgaggcattacaggttcaatggtgaaaatctttcacgtgaatcgatgaatgtaattg |
206 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||||||| ||||| ||||| ||||||||||||| |||||||||| ||||||| ||| ||||| |
|
|
| T |
12861681 |
agatttgatcatcgcttgcaaatgtggaaaaatcctcaggatttgaggaattacgagttcaatggtgaagctctttcacgtttatcgatggatgaaattg |
12861780 |
T |
|
| Q |
207 |
tggggaattggcttgatttc |
226 |
Q |
| |
|
|| |||| || |||| |||| |
|
|
| T |
12861781 |
tgaggaaatgtcttggtttc |
12861800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University