View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_429 (Length: 226)
Name: NF10140A_low_429
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10140A_low_429 |
 |  |
|
[»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 9538985 - 9539211
Alignment:
Q |
1 |
agttaagctttcgaggacatcacatgcatcagcttatagttgcagattcttctcacacaaatctttcagtgatatatcaatgttgttggaacattgttca |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |||||||||||| |||||||||||||||| | |
|
|
T |
9538985 |
agttaagctttcgaggacatcacatgcatcagtttatagttgcagattcttctcacacaaatttttcaatgatatatcaattttgttggaacattgttga |
9539084 |
T |
 |
Q |
101 |
attatttaaattatgaactaagttcaaatatgattttttaaatatacta-nnnnnnnnaactcatgcataagattagaaactcacatttagatttccttg |
199 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9539085 |
attatttaaattatgaactaagttcaaatatgattttttaaatatactatttttttttaactcatgcataagattagaaactcacatttagatttccttg |
9539184 |
T |
 |
Q |
200 |
tgttannnnnnncatttcaagtgtcat |
226 |
Q |
|
|
||||| ||||||||||||||| |
|
|
T |
9539185 |
tgttatttttttcatttcaagtgtcat |
9539211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University