View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_433 (Length: 225)
Name: NF10140A_low_433
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_433 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 119 - 211
Target Start/End: Original strand, 32139632 - 32139724
Alignment:
| Q |
119 |
attgcagtgttttatctctctcaatttcaaaagactgaagaggtacttctttgttgttatgcagtacaggcatgagttacttactatattatt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
32139632 |
attgcagtgttttatctctctcaatttcaaaagactgaagaggtacttctttgttgttatgcagtgcaggcatgagttacttaatatattatt |
32139724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 15 - 50
Target Start/End: Original strand, 32139534 - 32139569
Alignment:
| Q |
15 |
tggacatcacattgatttctttggtcaaacatgaca |
50 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32139534 |
tggacaccacattgatttctttggtcaaacatgaca |
32139569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University