View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_440 (Length: 223)
Name: NF10140A_low_440
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10140A_low_440 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 39 - 202
Target Start/End: Original strand, 25931945 - 25932108
Alignment:
Q |
39 |
tctccaagaatatcgtaacactggttatcactatcatccacactgtccaatataacttgttcattgctatctccatcatatcacccctctctctttttgt |
138 |
Q |
|
|
||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
25931945 |
tctccaacaatattataacactggttatcactatcatccacactgtccaatataacttgttcattgctatctccatgatatcacccctctctctttttgt |
25932044 |
T |
 |
Q |
139 |
gctcacactgaaatgtttgatttatactcccgagttttatacacttttactatttgacaagtgt |
202 |
Q |
|
|
||||||||||||||||||||||||||||| | | |||||||||||||| ||||||||||||||| |
|
|
T |
25932045 |
gctcacactgaaatgtttgatttatactctcaaattttatacactttttctatttgacaagtgt |
25932108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University