View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_444 (Length: 223)
Name: NF10140A_low_444
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_444 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 33 - 203
Target Start/End: Original strand, 20427047 - 20427209
Alignment:
| Q |
33 |
caagtagcttcaaattcgggaaggtctttccactgaatgaggacctcagcaacaccatc----agtagtgttgcgtacagctttgacatcagcagggaca |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
20427047 |
caagtagcttcaaattcgggaaggtctttccattgaatgaggacctcagcaacaccatccatcagtagtgttgcgtacagc------------agggaca |
20427134 |
T |
 |
| Q |
129 |
acttgtaattccatgtcttcagagagcattggcggaagtggttgtggatttgttgagggagaaatagctttcttc |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20427135 |
acttgtaattccatgtcttcagagagcattggcggaagtggttgtggatttgttgagggagaaatagctttcttc |
20427209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University