View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_445 (Length: 223)
Name: NF10140A_low_445
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_445 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 27 - 207
Target Start/End: Complemental strand, 33262239 - 33262059
Alignment:
| Q |
27 |
tgaatgacccaaaatcattgagctcagctcttctgaagttgggatgttgaaaggcagacttgctggcccttgcaatgtggcattctgcggttgcaaacta |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33262239 |
tgaatgacccaaaatcattgagctcagctcttctgaaattgggatgttgaaaggcagacttgttggcccttgcagtgtggcattctgcggttgcaaacta |
33262140 |
T |
|
| Q |
127 |
gtcattgttgacccctccaatatggcagtttgtggttgcagatgactaattgctggcccttccaacatggcactctgtggt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
33262139 |
gtcattgttgacccctccaatatggcagttcgtggttgcagattactaattgatggcccttccaacatggcagtctgtggt |
33262059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University