View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_450 (Length: 221)
Name: NF10140A_low_450
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_450 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 17 - 215
Target Start/End: Complemental strand, 38093125 - 38092931
Alignment:
| Q |
17 |
aatatattcaaggaaattttgcaacaagaacaaatattcctggatcccacaatttgaatgaagatcttgttctcatagacgtatcaaattgtccgaagga |
116 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38093125 |
aatatattcaaggaaattttgcaactagaacaaatattcgtggatcccacaatttgaatgaagatcttgttctcatagacgtatcgaattgtccgaagga |
38093026 |
T |
 |
| Q |
117 |
atcccattgtttcct-ttttccaatatttctcattcaagaaaacaacatatagggtttctttccctctgccccctttgagtcaattctgcatgctttgtt |
215 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||||||||||||||| |
|
|
| T |
38093025 |
atcccattgtttccttttttccaatatttctcattcaagaaaacaacatatagggtttct-----tgtgcaccctttgagtcaattctgcatgctttgtt |
38092931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University