View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_451 (Length: 221)
Name: NF10140A_low_451
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_451 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 19 - 219
Target Start/End: Original strand, 30138363 - 30138563
Alignment:
| Q |
19 |
actatgaaagcaatgtagggaatgaagattaaggttgttttgaagaatcctgctggaagacagaagaaaactccaatgcctgtggatgctgctgtgatta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30138363 |
actatgaaagcaatgtagggaatgaagattaaggttgttttgaagaatcctgctggaagacagaagaaaactccaatgcctgtggatgctgctgtgatta |
30138462 |
T |
|
| Q |
119 |
gggtttggtattggctgttaaggtggaaagagatgaaagtgaggattggaatggctaaggttaaacctgaagcccatgcaattgatgtccatctcattga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30138463 |
gggtttggtattggctgttaaggtggaaagagatgaaagtgaggattggaatggctaaggttaaacctgaagcccatgcaattgatgtccattccattga |
30138562 |
T |
|
| Q |
219 |
a |
219 |
Q |
| |
|
| |
|
|
| T |
30138563 |
a |
30138563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University