View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_458 (Length: 220)
Name: NF10140A_low_458
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10140A_low_458 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 20 - 204
Target Start/End: Complemental strand, 6073749 - 6073565
Alignment:
Q |
20 |
acttccatcctcctcgccggaatctctctccatcaaacctcaccgttcgtccgactttgcctacaccgccatccgcaaatccggcctcaccttccgtgac |
119 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6073749 |
acttccatcctcctcgccggaatctctctccatcaaacctcatcgttcctccgacttcgcctacaccgccatccgcaaatccggcctcaccttccgtgac |
6073650 |
T |
 |
Q |
120 |
ttccatctcctccgccgtataggcgccggcgacataggcaccgtttacctctgtcgcctccgtgactcctccgcaaatgaactcc |
204 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
6073649 |
ttccatctcctccgccgtataggcgccggcgacataggcaccgtttacctctgtcgcctccgtgactcctcctcaaatgaactcc |
6073565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 44 - 178
Target Start/End: Original strand, 37170044 - 37170181
Alignment:
Q |
44 |
tctctccatcaaacctcaccgttcgtccgactttgcctacaccgccatccg---caaatccggcctcaccttccgtgacttccatctcctccgccgtata |
140 |
Q |
|
|
||||||| ||||||||||||| || |||||||| || ||| |||||||||| ||| |||| ||||| || ||||||||||| |||||||||||||| |
|
|
T |
37170044 |
tctctccctcaaacctcaccgctcctccgacttcgcttactccgccatccgtcgcaagtccgctctcacatttcgtgacttccacctcctccgccgtatc |
37170143 |
T |
 |
Q |
141 |
ggcgccggcgacataggcaccgtttacctctgtcgcct |
178 |
Q |
|
|
|||||||| || || || || |||||||| || ||||| |
|
|
T |
37170144 |
ggcgccggagatatcggtactgtttacctatgccgcct |
37170181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University