View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_459 (Length: 220)
Name: NF10140A_low_459
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_459 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 64 - 164
Target Start/End: Complemental strand, 9867765 - 9867665
Alignment:
| Q |
64 |
atgttgaagtcttcaaccctttgannnnnnnngattctcccccttgccgcgagaaactctgaaacttggcatgtcgtcgatcatcctcccaggtcccata |
163 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
9867765 |
atgttgaagtcttcaaccctttgatgactattgattctcccccttgccgcgagaaactctgaaacttggcatgtcctcgatcatcctcccatgacccata |
9867666 |
T |
|
| Q |
164 |
t |
164 |
Q |
| |
|
| |
|
|
| T |
9867665 |
t |
9867665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 9867887 - 9867821
Alignment:
| Q |
1 |
tgtgatccaattaccacaaagatcgctactaaaggcaacccacaatcgactagtcttttgcgaatgt |
67 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
9867887 |
tgtgatccaattaccactacgatcgctactaaaggcaaaccacagtcgactagtcttttgcgaatgt |
9867821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University