View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_46 (Length: 397)
Name: NF10140A_low_46
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_46 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 68; Significance: 3e-30; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 34637888 - 34637821
Alignment:
| Q |
1 |
tcatgaaatatagaagaataattttttataatttatttatcctggatcgtttaatcggtactattttt |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34637888 |
tcatgaaatatagaagaataattttttataatttatttatcctggatcgtttaatcggtactattttt |
34637821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 356 - 388
Target Start/End: Original strand, 36467877 - 36467909
Alignment:
| Q |
356 |
gcctagtggctagaattcacatgaataaatggg |
388 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
36467877 |
gcctagtggctagaattcacatgaataagtggg |
36467909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University