View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_461 (Length: 220)
Name: NF10140A_low_461
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_461 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 16 - 200
Target Start/End: Original strand, 7012234 - 7012418
Alignment:
| Q |
16 |
attattctgagttgaagtatttactttcattatatctaccttcacaatgtggtgatcagaagttcctttagaagaaattactgagtatgaccctggaaca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7012234 |
attattctgagttgaagtatttactttcattatatctaccttcacaatgtggtgatcagaagttcctttagaagaaattactgagtatgaccctggaaca |
7012333 |
T |
 |
| Q |
116 |
aatttgtatggtgattttgatgaacccaaaatataatccacccttgttccatacttgcatgtcccctgcacatctatattcaaca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7012334 |
aatttgtatggtgattttgatgaacccaaaatataatccacccttgttccatacttgcatgtcccctgcacatctatattcaaca |
7012418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University