View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_463 (Length: 219)
Name: NF10140A_low_463
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_463 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 20 - 64
Target Start/End: Original strand, 9913673 - 9913717
Alignment:
| Q |
20 |
atatgtatacatacatgactcaatttctctaatttagtgtctcac |
64 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9913673 |
atatgtatacatacatcactcaatttctctaatttagtgtctcac |
9913717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 155 - 208
Target Start/End: Original strand, 9913808 - 9913861
Alignment:
| Q |
155 |
gaggaacccaaaaaagtgaagaaagtcacataatgaataaaatatatattcttc |
208 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| | |||||||||||| |||||| |
|
|
| T |
9913808 |
gaggaacccaaaaaagtgaagagagtcacatagtaaataaaatatattttcttc |
9913861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University