View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_465 (Length: 218)
Name: NF10140A_low_465
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_465 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 14 - 218
Target Start/End: Complemental strand, 35559179 - 35558975
Alignment:
| Q |
14 |
tggtggtaaggggaaaaccttgcctcgtgtaacgaatcgtgatgacgagattaatgacacgataccgagtttgggatcggagactaatttcaggaatggg |
113 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35559179 |
tggtggtaaggggaaaaccttgcctcgggtaacgaatcgtgatgacgagattaatgacacgataccgagtttgggatcggagactaatttcaggaatggg |
35559080 |
T |
|
| Q |
114 |
aagtatttgtattattcgcgaggtggtgattattgtaagggtatgaatcattttatgtggagttttttgtgtggtttaggtgaagctatgtttttgaata |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35559079 |
aagtatttgtattattcgcgaggtggtgattattgtaagggtatgaatcattttatgtggagttttttgtgtggtttaggtgaagctatgtttttgaata |
35558980 |
T |
|
| Q |
214 |
gaact |
218 |
Q |
| |
|
||||| |
|
|
| T |
35558979 |
gaact |
35558975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University