View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_466 (Length: 218)
Name: NF10140A_low_466
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_466 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 14 - 208
Target Start/End: Complemental strand, 34344938 - 34344744
Alignment:
| Q |
14 |
gggactgagtgtagtgttaactgctagagacaagaagaaaggagaggattctgtggagatgattcgagcacaattaggccttgttgcacctcatcatcat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34344938 |
gggactgagtgtagtgttaactgctagagacaagaagaaaggagaggatgctgtggagagaattcgagcacaattaggccttgttgcacctcatcatcat |
34344839 |
T |
|
| Q |
114 |
gttcactttctagtccttgatgtctcagatgctgattctattcaaacctttgcatcctccttcaaagacaaatttggagccaccttggatattct |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34344838 |
gttcactttctagtccttgatgtctcagatgctgattctattaaaacctttgcatcctccttcaaagacaaatttggagccaccttggatattct |
34344744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University