View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_468 (Length: 217)
Name: NF10140A_low_468
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10140A_low_468 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 1e-98; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 16 - 201
Target Start/End: Original strand, 47719783 - 47719968
Alignment:
Q |
16 |
atgcaccttagacgaataattgtgttattttatttttgatattctttggtggatgagtcagtgaaacggatacatttgttattgattatttgttttgatt |
115 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47719783 |
atgcaccttagacgaataattgagttattttatttttgatattctttggtggatgagtcagtgaaacggatacatttgttattgattatttgttttgatt |
47719882 |
T |
 |
Q |
116 |
ctttcctggtcaatttgggcgtcttgcctttttggggttttgctgttgttgtagcctcctgtagtacctatgatgatgttgtttat |
201 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47719883 |
ctttcctggtcaatttgggcgtcttgcctttttggggttttgctgttgttgtagcctcctgtagtacctatgatgatgttgtttat |
47719968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 27 - 201
Target Start/End: Original strand, 47726786 - 47726960
Alignment:
Q |
27 |
acgaataattgtgttattttatttttgatattctttggtggatgagtcagtgaaacggatacatttgttattgattatttgttttgattctttcctggtc |
126 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47726786 |
acgaataattgagttattttatttttgatattctttggtggatgagtcagtgaaacggatacatttgttattgattatttgttttgattctttcctggtc |
47726885 |
T |
 |
Q |
127 |
aatttgggcgtcttgcctttttggggttttgctgttgttgtagcctcctgtagtacctatgatgatgttgtttat |
201 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47726886 |
aatttgggcgtcttgcctttttggggttttgctgttgttgtagcctcctgtagtacctatgatgatgttgtttat |
47726960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 27 - 154
Target Start/End: Original strand, 47748092 - 47748219
Alignment:
Q |
27 |
acgaataattgtgttattttatttttgatattctttggtggatgagtcagtgaaacggatacatttgttattgattatttgttttgattctttcctggtc |
126 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47748092 |
acgaataattgagttattttatttttgatattctttggtggatgagtcagtgaaacggatacatttgttattgattatttgttttgattctttcctggtc |
47748191 |
T |
 |
Q |
127 |
aatttgggcgtcttgcctttttggggtt |
154 |
Q |
|
|
||||||||||||||||||||| |||||| |
|
|
T |
47748192 |
aatttgggcgtcttgccttttaggggtt |
47748219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University