View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_470 (Length: 216)
Name: NF10140A_low_470
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_470 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 25933823 - 25933608
Alignment:
| Q |
1 |
aacactgaactatctgtatgaacctccatgccccgaccaacatcagtgggtggataacgatagacacgtatgttgccattgttttctgataaatatgact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25933823 |
aacactgaactatctgtatgaacctccatgccccaaccaacatcagtgggtggataacgatagacacgtatgttgccattgttttctgataaatatgact |
25933724 |
T |
 |
| Q |
101 |
ttgttgtcttcagattcagatcaaggttcttaaccattgcttcaaataatgttgtagcaattcttaaaagatgggttgcatattccattagtaaaagcct |
200 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25933723 |
ttgttgttttcagattcagctcaaggttcttaaccattgcttcaaataatgttgtagcaattcttaaaagatgggttgcatattccattagtaaaagcct |
25933624 |
T |
 |
| Q |
201 |
gcttgcaaaggaaaca |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
25933623 |
gcttgcaaaggaaaca |
25933608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University