View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_475 (Length: 213)
Name: NF10140A_low_475
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_475 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 15 - 129
Target Start/End: Complemental strand, 41424253 - 41424139
Alignment:
| Q |
15 |
acatcaaaccaaatttnnnnnnngcaagaaacataaggcatggtgaatttgctttccatcctcaaacagcaacattgaagaagagagcaattaatgccaa |
114 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41424253 |
acatcaaaccaaatttaaaaaaagcaagaaacataaggcatggtgaatttgctttccatcctccaacagcaacattgaagatgagagcaattaatgccaa |
41424154 |
T |
 |
| Q |
115 |
actagagaaagccaa |
129 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
41424153 |
actagagaaagccaa |
41424139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University