View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_485 (Length: 209)
Name: NF10140A_low_485
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_485 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 29 - 188
Target Start/End: Original strand, 31828144 - 31828303
Alignment:
| Q |
29 |
ttatggagcatttggaaggcgagaaacgctnnnnnnnntcaggacaaaaaggtctcaactgataagattgtagatcaagtcggattactctcttggaact |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31828144 |
ttatggagcatttggaaggcgagaaacgctaaaaaaattcaggacaaaaaggtctcgactgataagattgtagatcaagtcagattactctcttggaact |
31828243 |
T |
 |
| Q |
129 |
ggttaacaaaatccacaatcttcaaatatgaactggatcagtggtggtcgtgtcctcttg |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31828244 |
ggttaacaaaatccacaatcttcaaatatgaactggatcagtggtggtcgtgtcctcttg |
31828303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University