View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_489 (Length: 209)
Name: NF10140A_low_489
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_489 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 21 - 190
Target Start/End: Complemental strand, 45513124 - 45512952
Alignment:
| Q |
21 |
aaaacgacatcgatatccc-tctagtttcgaaactaacattaacctcccgtaaattttaatcaaatagacaatcaccccgtctctgttaacagttaattt |
119 |
Q |
| |
|
||||||||||||| | ||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45513124 |
aaaacgacatcgacaccccctctagtttcgaaactaacattaacctcccgtaagttttaatcaaatagacaatcaccccgtctctattaacagttaattt |
45513025 |
T |
|
| Q |
120 |
ttccgttaactcttcttagagaatcttctgttaac--attgtggggacaaaccttcattgttgaatctaagtc |
190 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
45513024 |
ttccgttaactcttcttaaagaatcttctgttaacatattgtggggacaaaccttcattgttgaatctaagtc |
45512952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 65; Significance: 9e-29; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 37 - 184
Target Start/End: Complemental strand, 35744568 - 35744417
Alignment:
| Q |
37 |
ccctctagtttcgaaactaacattaacctcccgtaaattttaatcaaatagacaatcaccccgt-ctctgttaaca--gttaatttttccgttaactctt |
133 |
Q |
| |
|
||||||| |||| ||||||||||||||||||| | ||||||||||||||| |||| ||||| | |||| |||||| |||||||||||| |||| | || |
|
|
| T |
35744568 |
ccctctaatttcaaaactaacattaacctcccttgaattttaatcaaataaacaaacaccctattctctattaacaccgttaatttttcccttaattttt |
35744469 |
T |
|
| Q |
134 |
-cttagagaatcttctgttaacattgtggggacaaaccttcattgttgaatc |
184 |
Q |
| |
|
|||| |||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
35744468 |
tcttaaagaatcttctattaaaattgtggggacaaaccttcattgttgaatc |
35744417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University