View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_495 (Length: 207)
Name: NF10140A_low_495
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_495 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 34899714 - 34899524
Alignment:
| Q |
1 |
tattataacatttgcatatgcttgtgtggtacgttacgcataaaaaccaagtggaacatgtcaactgacccactaattgaggttctcctaataactaaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34899714 |
tattataacatttgcatatgcttgtgtggtac-ttacgcataaaaaccaagtggaacatgtcaactgacccactagttgaggttctcctaataactaaga |
34899616 |
T |
|
| Q |
101 |
acatttttagagacacattttcgatattcaattttctgcattcagctaccaactaattatttgtaagtcttagcagacacttcttcatagat |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899615 |
acatttttagagacacattttcgatattcaattttctgcattcagctaccaactaattatttgtaagtcttagcagacacttcttcatagat |
34899524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University